Display Settings:

Format

Send to:

Choose Destination
Pr012817142

STS probe D2S2636 for apurinic/apyrimidinic endodeoxyribonuclease 1 (APEX1) and 5 more genes

Synopsis

Field NameValues
NameD2S2636
AliasesMM3052; RH44076; RH53565; UTR-03316; WI-9010; mm3052; stSG333
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100288648; LOC100292955; APEX1; APEX1; TMEM55B; TMEM55B
UniSTS IDUniSTS:70413

Sequences

>Probe|12817142|PRIMERF Forward PCR primer (outermost) (19b)
TGAGCCTGGGAAATAAGCC
>Probe|12817142|PRIMERR Reverse PCR primer (outermost) (22b)
GAACTCTATCACAGGAGCCTGG

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB4141.41 cr3000WI-9010
Homo sapiensradiation hybridGeneMap99-GB4143.43 cr3000mm3052
Homo sapienslinkageRutgers Map14 cmD2S2636

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID70413
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678068
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center