Display Settings:

Format

Send to:

Choose Destination
Pr012816031

STS probe SHGC-36637 for taurine up-regulated 1 (non-protein coding) (TUG1) and 1 more gene

Synopsis

Field NameValues
NameSHGC-36637
AliasRH37895
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100583447; TUG1
UniSTS IDUniSTS:69404

Sequences

>Probe|12816031|PRIMERF Forward PCR primer (outermost) (25b)
TGAAAGTTTCATGTGATCTACACTG
>Probe|12816031|PRIMERR Reverse PCR primer (outermost) (25b)
GTGTGTGCTTATGTTTATAAATGCA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G322685 cr10000SHGC-36637
Homo sapiensradiation hybridGeneMap99-G322685 cr10000SHGC-36637
Homo sapienslinkageRutgers Map22 cmSHGC-36637
Homo sapiensradiation hybridNCBI RH22137.3 crSHGC-36637

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID69404
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center