Display Settings:

Format

Send to:

Choose Destination
Pr012815925

STS probe WI-9128 for ETS proto-oncogene 2, transcription factor (ETS2) and 1 more gene

Synopsis

Field NameValues
NameWI-9128
AliasesETS1; UTR-01988
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesETS2; ETS2
UniSTS IDUniSTS:69308

Sequences

>Probe|12815925|PRIMERF Forward PCR primer (outermost) (21b)
TGAAAATGTCCAGGAAAGTGG
>Probe|12815925|PRIMERR Reverse PCR primer (outermost) (19b)
ATTAGCTGTGCCGTTGCTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map21 cmWI-9128

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID69308
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678125
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center