Display Settings:

Format

Send to:

Choose Destination
Pr012815639

STS probe D5S487 for sarcoglycan delta (SGCD) and 1 more gene

Synopsis

Field NameValues
NameD5S487
Aliases210VG3; AFM210vg3; HS210VG3; RH42259; RH59709; RH6201
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSGCD; SGCD
UniSTS IDUniSTS:69049

Sequences

>Probe|12815639|PRIMERF Forward PCR primer (outermost) (20b)
TCTTGGTAAGCCCACAATGA
>Probe|12815639|PRIMERR Reverse PCR primer (outermost) (20b)
CTGGCCTTGGAAATTAGACC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

Show All 4 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

4.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageMarshfield5158.12 cmAFM210vg3
Homo sapienslinkagedeCODE5160.8 cmD5S487
Homo sapienslinkageGenethon5157.6 cmAFM210vg3
Homo sapiensradiation hybridWhitehead-RH5505.6 cr3000D5S487

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:189396
UniSTS IDcontext specific help for: UniSTS ID69049
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center