Display Settings:

Format

Send to:

Choose Destination
Pr012815161

STS probe STS-N93869 for CENPB DNA-binding domains containing 1 pseudogene 1 (CENPBD1P1) and 2 more genes

Synopsis

Field NameValues
NameSTS-N93869
AliasesRH74785; sts-N93869
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100602847; CENPBD1; CENPBD1P1
UniSTS IDUniSTS:68616

Sequences

>Probe|12815161|PRIMERF Forward PCR primer (outermost) (20b)
TCTGTCACCCAGGCTGTACC
>Probe|12815161|PRIMERR Reverse PCR primer (outermost) (20b)
GGACGTTCATTTTCCTGTGG

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB419298 cr3000sts-N93869
Homo sapiensradiation hybridNCBI RH19600.5 crsts-N93869

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID68616
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center