Display Settings:

Format

Send to:

Choose Destination
Pr012814271

STS probe G36043 for retinitis pigmentosa GTPase regulator interacting protein 1 (RPGRIP1) and 1 more gene

Synopsis

Field NameValues
NameG36043
Aliash14a1554
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesRPGRIP1; RPGRIP1
UniSTS IDUniSTS:67804

Sequences

>Probe|12814271|PRIMERF Forward PCR primer (outermost) (20b)
TCTCAAGCACATGTTCCAGC
>Probe|12814271|PRIMERR Reverse PCR primer (outermost) (22b)
GGATGACCTAAAACCAAGGAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map14 cmG36043

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID67804
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center