Display Settings:

Format

Send to:

Choose Destination
Pr012814062

STS probe D14S49 for neuronal PAS domain protein 3 (NPAS3) and 4 more genes

Synopsis

Field NameValues
NameD14S49
AliasesHUMGTREPB; Mfd119A
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesNPAS3; NPAS3; NPAS3; NPAS3; NPAS3
UniSTS IDUniSTS:67613

Sequences

>Probe|12814062|PRIMERF Forward PCR primer (outermost) (21b)
TCTACAAAAAGTCAGATACCT
>Probe|12814062|PRIMERR Reverse PCR primer (outermost) (22b)
GAATCTTAAGTAGTTATCCCTC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map14 cmD14S49
Homo sapienslinkageMarshfield1436.76 cmMfd119A

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID67613
Probe Cross-refcontext specific help for: Probe Cross-refGDB:191681
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center