Display Settings:

Format

Send to:

Choose Destination
Pr012813322

STS probe D8S1950 for RUNX1 translocation partner 1 (RUNX1T1) and 21 more genes

Synopsis

Field NameValues
NameD8S1950
AliasesUTR-05151; WI-9208
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesRUNX1T1; RUNX1T1; RUNX1T1; RUNX1T1; RUNX1T1; RUNX1T1; RUNX1T1; RUNX1T1; LOC100541858; runx1t1; RUNX1T1; RUNX1T1; Runx1t1; Runx1t1More
UniSTS IDUniSTS:66943

Sequences

>Probe|12813322|PRIMERF Forward PCR primer (outermost) (24b)
TCCTCCCTGTTATTTTCAAGTAGC
>Probe|12813322|PRIMERR Reverse PCR primer (outermost) (21b)
TGCTTTCAACAGCAATTAGCA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map8 cmD8S1950

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID66943
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678171; RGD:5027725
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center