Display Settings:

Format

Send to:

Choose Destination
Pr012812906

STS probe D15S1318 for PIF1 5'-to-3' DNA helicase (PIF1) and 2 more genes

Synopsis

Field NameValues
NameD15S1318
AliasesD15S1358; RH8773; SHGC-13832
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPIF1; PIF1; PIF1
UniSTS IDUniSTS:66568

Sequences

>Probe|12812906|PRIMERF Forward PCR primer (outermost) (20b)
TCCCCTGAAAAAGCAGCTTA
>Probe|12812906|PRIMERR Reverse PCR primer (outermost) (20b)
GCAGCCTCCAAACAGAGAAC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3151908 cr10000SHGC-13832
Homo sapiensradiation hybridGeneMap99-G3151908 cr10000SHGC-13832
Homo sapiensradiation hybridNCBI RH15387.1 crSHGC-13832

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:738016; GDB:738829
UniSTS IDcontext specific help for: UniSTS ID66568
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center