Display Settings:

Format

Send to:

Choose Destination
Pr012812610

STS probe D7S630 for zinc finger protein 804B (ZNF804B) and 2 more genes

Synopsis

Field NameValues
NameD7S630
Aliases165YH12; AFM165YH12; AFM165yh12; HS165YH12; RH34306; RH72295; SHGC-5390; sWSS1065
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesZNF804B; ZNF804B; ZNF804B
UniSTS IDUniSTS:66299

Sequences

>Probe|12812610|PRIMERF Forward PCR primer (outermost) (20b)
TCCATTCTGAGGTTTGATGT
>Probe|12812610|PRIMERR Reverse PCR primer (outermost) (20b)
CCATGGTCTTTTCAATGAAC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 5 References...

3.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

4.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

5.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G374110 cr10000SHGC-5390
Homo sapiensradiation hybridGeneMap99-G374110 cr10000AFM165yh12
Homo sapienslinkageRutgers Map7 cmD7S630
Homo sapienslinkageMarshfield798.44 cmAFM165yh12
Homo sapienslinkagedeCODE799.93 cmD7S630
Homo sapienslinkageGenethon798.7 cmAFM165yh12

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID66299
Probe Cross-refcontext specific help for: Probe Cross-refGDB:199105
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center