Display Settings:

Format

Send to:

Choose Destination
Pr012812364

STS probe GDB:1317244 for transferrin receptor 2 (TFR2) and 2 more genes

Synopsis

Field NameValues
NameGDB:1317244
AliassWSS1018
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTFR2; TFR2; TFR2
UniSTS IDUniSTS:66075

Sequences

>Probe|12812364|PRIMERF Forward PCR primer (outermost) (20b)
TCCAGCCACATGGTTCTTTC
>Probe|12812364|PRIMERR Reverse PCR primer (outermost) (20b)
TGCCAGTGAGAATCGTTCAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map7 cmGDB:1317244

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID66075
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center