Display Settings:

Format

Send to:

Choose Destination
Pr012811323

STS probe AL031253 for FERM domain containing 7 (FRMD7) and 1 more gene

Synopsis

Field NameValues
NameAL031253
AliasstSG50125
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesFRMD7; FRMD7
UniSTS IDUniSTS:65136

Sequences

>Probe|12811323|PRIMERF Forward PCR primer (outermost) (21b)
TCAGGTCATTAAGAAAGGGGC
>Probe|12811323|PRIMERR Reverse PCR primer (outermost) (21b)
TCCCCATACAGGATTTTTTCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmAL031253

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID65136
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center