Display Settings:

Format

Send to:

Choose Destination
Pr012811035

Macaca mulatta and Homo sapiens STS probe D9S922

Synopsis

Field NameValues
NameD9S922
AliasesCHLC.GATA21F05; CHLC.GATA21F05.P8950; GATA-D9S922; GATA21F05; RH28120; RH30529; RH62939; RH7521; SHGC-18066
TypeSTS
Application
Source organism
Source sequence
Target organismsMacaca mulatta; Homo sapiens
UniSTS IDUniSTS:64876

Sequences

>Probe|12811035|PRIMERF Forward PCR primer (outermost) (20b)
TCAGAGGACCACTGCCTAAG
>Probe|12811035|PRIMERR Reverse PCR primer (outermost) (20b)
CTGATGGGATTTGTGCCTAT

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A rhesus macaque radiation hybrid map and comparative analysis with the human genome.

Murphy WJ, Agarwala R, Schäffer AA, Stephens R, Smith C Jr, Crumpler NJ, David VA, O'Brien SJ.

Genomics. 2005 Oct;86(4):383-95.

Show All 6 References...

3.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

4.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

5.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

6.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G392531 cr10000SHGC-18066
Homo sapienslinkageRutgers Map9 cmD9S922
Macaca mulattaradiation hybridRH15421.2..2.8 crD9S922
Homo sapienslinkageMarshfield980.31 cmGATA21F05
Homo sapienslinkagedeCODE977.77 cmD9S922
Homo sapiensradiation hybridNCBI RH9727.7 crSHGC-18066
Homo sapiensradiation hybridWhitehead-RH9308.8 cr3000CHLC.GATA21F05

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID64876
Probe Cross-refcontext specific help for: Probe Cross-refGDB:684414
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center