Display Settings:

Format

Send to:

Choose Destination
Pr012810144

STS probe SHGC-34349 for DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease (DIS3) and 3 more genes

Synopsis

Field NameValues
NameSHGC-34349
AliasesEST51019; RH33207; RH53177; SGC34349
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesDIS3; DIS3; BORA; BORA
UniSTS IDUniSTS:64068

Sequences

>Probe|12810144|PRIMERF Forward PCR primer (outermost) (20b)
TCAACATGATGGTGACTGGG
>Probe|12810144|PRIMERR Reverse PCR primer (outermost) (21b)
TCAGCAACTTGAAGTTCCAGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 5 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

4.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

5.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3131851 cr10000SHGC-34349
Homo sapiensradiation hybridGeneMap99-G3131844 cr10000SHGC-34349
Homo sapiensradiation hybridGeneMap99-GB413210.67 cr3000SGC34349
Homo sapienslinkageRutgers Map13 cmSHGC-34349
Homo sapiensradiation hybridNCBI RH13611.8 crSHGC-34349
Homo sapiensradiation hybridWhitehead-RH13183.9 cr3000SGC34349

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID64068
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center