Display Settings:

Format

Send to:

Choose Destination
Pr012809755

STS probe D6S1053 for eyes shut homolog (Drosophila) (EYS) and 4 more genes

Synopsis

Field NameValues
NameD6S1053
AliasesCHLC.GATA64D02; CHLC.GATA64D02.P17876; GATA-D6S1053; GATA64D02; RH28069; RH30441; RH35700; RH61222; RH6739; SHGC-17948; stSG6057
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesEYS; EYS; EYS; LOC389405; EYS
UniSTS IDUniSTS:63715

Sequences

>Probe|12809755|PRIMERF Forward PCR primer (outermost) (20b)
TATTTCAAAGGCAGCAAAGC
>Probe|12809755|PRIMERR Reverse PCR primer (outermost) (20b)
GCTTGCAGACAGCCTATTGT

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

Show All 4 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

4.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G363084 cr10000SHGC-17948
Homo sapienslinkageRutgers Map6 cmD6S1053
Homo sapienslinkageMarshfield680.45 cmGATA64D02
Homo sapiensradiation hybridNCBI RH6763.9 crSHGC-17948
Homo sapiensradiation hybridWhitehead-RH6445.5 cr3000CHLC.GATA64D02

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID63715
Probe Cross-refcontext specific help for: Probe Cross-refGDB:685344
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center