Display Settings:

Format

Send to:

Choose Destination
Pr012809085

STS probe D1S3313 for solute carrier family 22, member 27 (Slc22a27) and 12 more genes

Synopsis

Field NameValues
NameD1S3313
AliasesUTR-00346; WI-7559
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100511772; LOC100515938; LOC100625358; Slc22a27; A2M; LOC539544; EEF1A1; LOC617438; Gm6192; LOC629473; LOC630846; LOC633015; Gm7105
UniSTS IDUniSTS:63106

Sequences

>Probe|12809085|PRIMERF Forward PCR primer (outermost) (21b)
TATCCCTAATACCTGCCACCC
>Probe|12809085|PRIMERR Reverse PCR primer (outermost) (24b)
TTTAATGGGTCTCAAAATTCTGTG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:677562
UniSTS IDcontext specific help for: UniSTS ID63106
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center