Display Settings:

Format

Send to:

Choose Destination
Pr012808811

STS probe WI-10121 for splicing factor 3a subunit 1 (SF3A1) and 2 more genes

Synopsis

Field NameValues
NameWI-10121
AliasEST125194
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSF3A1; SF3A1; SF3A1
UniSTS IDUniSTS:62854

Sequences

>Probe|12808811|PRIMERF Forward PCR primer (outermost) (25b)
TATACACTGGTATGTGTACCCATGA
>Probe|12808811|PRIMERR Reverse PCR primer (outermost) (25b)
TCACTTTCAGTTCTACCCACTACTT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmWI-10121

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID62854
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center