Display Settings:

Format

Send to:

Choose Destination
Pr012808748

STS probe D15S1030 for ATP/GTP binding protein like 1 (AGBL1) and 3 more genes

Synopsis

Field NameValues
NameD15S1030
AliasesAFM309ZF1; AFM309zf1; HS309ZF1; RH31354; SHGC-20926
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesAGBL1; AGBL1; LOC728206; LOC731136
UniSTS IDUniSTS:62797

Sequences

>Probe|12808748|PRIMERF Forward PCR primer (outermost) (20b)
TATAAAAGGCCCAACAGAGG
>Probe|12808748|PRIMERR Reverse PCR primer (outermost) (24b)
CTGAATAATGAGCAGATATGCAAG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 6 References...

3.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

4.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

5.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

6.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3153213 cr10000SHGC-20926
Homo sapiensradiation hybridGeneMap99-G3153208 cr10000AFM309zf1
Homo sapienslinkageRutgers Map15 cmD15S1030
Homo sapienslinkageMarshfield1582.28 cmAFM309zf1
Homo sapienslinkagedeCODE1591.49 cmD15S1030
Homo sapienslinkageGenethon1580.4 cmAFM309zf1
Homo sapiensradiation hybridNCBI RH15674.8 crAFM309zf1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID62797
Probe Cross-refcontext specific help for: Probe Cross-refGDB:612774
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center