Display Settings:

Format

Send to:

Choose Destination
Pr031803701

STS probe UniSTS:62643

Synopsis

Field NameValues
NameUniSTS:62643
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:62643

Sequences

>Probe|31803701|PRIMERF Forward PCR primer (outermost) (22b)
TAGTATTCCATGGTGTATATGT
>Probe|31803701|PRIMERR Reverse PCR primer (outermost) (19b)
CTATAAAGACACATGCACA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID62643
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center