Display Settings:

Format

Send to:

Choose Destination
Pr012808265

STS probe SHGC-37168 for ubiquitin conjugating enzyme E2 D3 (UBE2D3) and 5 more genes

Synopsis

Field NameValues
NameSHGC-37168
AliasRH82461
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100426901; UBE2D3; UBE2D3; UBE2D3; UBE2D3; UBE2D3
UniSTS IDUniSTS:62357

Sequences

>Probe|12808265|PRIMERF Forward PCR primer (outermost) (21b)
TAGCTTTCCACATGTGTGTGC
>Probe|12808265|PRIMERR Reverse PCR primer (outermost) (25b)
AAAGTTCTAGCACATCTGTGACTCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map4 cmSHGC-37168

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID62357
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center