Display Settings:

Format

Send to:

Choose Destination
Pr012807303

STS probe GDB:6028491 for phosphodiesterase 1C (PDE1C) and 3 more genes

Synopsis

Field NameValues
NameGDB:6028491
AliasesHSU10574; sWSS1823
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPDE1C; PDE1C; PDE1C; PDE1C
UniSTS IDUniSTS:61486

Sequences

>Probe|12807303|PRIMERF Forward PCR primer (outermost) (21b)
TACCAAATGATTAGTTCCATT
>Probe|12807303|PRIMERR Reverse PCR primer (outermost) (20b)
GTCCAGGTCTACTGACATCT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map7 cmGDB:6028491

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID61486
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center