Display Settings:

Format

Send to:

Choose Destination
Pr012807156

STS probe D17S786 for phosphoinositide-3-kinase regulatory subunit 5 (PIK3R5) and 1 more gene

Synopsis

Field NameValues
NameD17S786
Aliases051XD10; AFM051xd10; HS051XD10; RH15021; RH4162; RH54896; RH9397
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPIK3R5; PIK3R5
UniSTS IDUniSTS:61353

Sequences

>Probe|12807156|PRIMERF Forward PCR primer (outermost) (20b)
TACAGGGATAGGTAGCCGAG
>Probe|12807156|PRIMERR Reverse PCR primer (outermost) (20b)
GGATTTGGGCTCTTTTGTAA

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

Show All 5 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

4.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

5.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map17 cmD17S786
Homo sapienslinkageMarshfield1717.38 cmAFM051xd10
Homo sapienslinkagedeCODE1723.36 cmD17S786
Homo sapienslinkageGenethon1718.1 cmAFM051xd10
Homo sapiensradiation hybridNCBI RH17262.3 crAFM051xd10
Homo sapiensradiation hybridWhitehead-RH1793 cr3000D17S786

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID61353
Probe Cross-refcontext specific help for: Probe Cross-refGDB:187877
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center