Display Settings:

Format

Send to:

Choose Destination
Pr012806655

STS probe A002R43 for chromosome 20 open reading frame 194 (C20orf194) and 3 more genes

Synopsis

Field NameValues
NameA002R43
AliasRH25035
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesC13H20orf194; C20orf194; C20H20orf194; C10H20orf194
UniSTS IDUniSTS:60901

Sequences

>Probe|12806655|PRIMERF Forward PCR primer (outermost) (23b)
TAATATATTTACTGACAAGCCCT
>Probe|12806655|PRIMERR Reverse PCR primer (outermost) (23b)
TGATATTTAGGTGATGTCTCTTA

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB415348.41 cr3000A002R43
Homo sapienslinkageRutgers Map20 cmA002R43
Homo sapiensradiation hybridNCBI RH15733.7 crA002R43

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID60901
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center