Display Settings:

Format

Send to:

Choose Destination
Pr012806642

STS probe D16S3232 for RNA binding protein, fox-1 homolog 1 (RBFOX1) and 2 more genes

Synopsis

Field NameValues
NameD16S3232
AliasesMR6822; WI-4274
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100603895; RBFOX1; LOC750335
UniSTS IDUniSTS:6089

Sequences

>Probe|12806642|PRIMERF Forward PCR primer (outermost) (24b)
AATGCAATATACAAAAACTCACCC
>Probe|12806642|PRIMERR Reverse PCR primer (outermost) (25b)
ATTTTAAACAATTTTGTCATCACCA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map16 cmD16S3232

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID6089
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678647
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center