Display Settings:

Format

Send to:

Choose Destination
Pr012806321

STS probe D9S1989 for proteasome subunit beta 7 (PSMB7) and 4 more genes

Synopsis

Field NameValues
NameD9S1989
AliasesMR12658; WI-9888
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPSMB7; PSMB7; PSMB7; PSMB7; PSMB7
UniSTS IDUniSTS:60595

Sequences

>Probe|12806321|PRIMERF Forward PCR primer (outermost) (24b)
TAACTGTTCTGAAAAGTGCTCTGG
>Probe|12806321|PRIMERR Reverse PCR primer (outermost) (24b)
GAATTAATGTATGGGTGCTCTTCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map9 cmD9S1989

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID60595
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678494
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center