Display Settings:

Format

Send to:

Choose Destination
Pr012805773

STS probe SGC34915 for phosphoinositide-3-kinase regulatory subunit 5 (PIK3R5) and 4 more genes

Synopsis

Field NameValues
NameSGC34915
AliasesEST382407; RH55025
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPIK3R5; PIK3R6; PIK3R5; PIK3R5; PIK3R5
UniSTS IDUniSTS:60096

Sequences

>Probe|12805773|PRIMERF Forward PCR primer (outermost) (22b)
TAAAATGGAGTGGAGAGTTGGG
>Probe|12805773|PRIMERR Reverse PCR primer (outermost) (23b)
GTTCAGAAAGTCAGGCACTAAGC

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map17 cmSGC34915
Homo sapiensradiation hybridNCBI RH17159.1 crSGC34915
Homo sapiensradiation hybridWhitehead-RH17155.2 cr3000SGC34915

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID60096
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center