Display Settings:

Format

Send to:

Choose Destination
Pr012804662

STS probe SHGC-16476 for major facilitator superfamily domain containing 8 (MFSD8) and 3 more genes

Synopsis

Field NameValues
NameSHGC-16476
AliasRH82590
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMFSD8; MFSD8; MFSD8; MFSD8
UniSTS IDUniSTS:59094

Sequences

>Probe|12804662|PRIMERF Forward PCR primer (outermost) (21b)
GTTCATGCAACCACAAAAAGG
>Probe|12804662|PRIMERR Reverse PCR primer (outermost) (25b)
TTGAAGAACAAGAACATATGTTGAA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map4 cmSHGC-16476

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID59094
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center