Display Settings:

Format

Send to:

Choose Destination
Pr012804052

STS probe SHGC-12634 for prostaglandin E receptor 2 (PTGER2) and 2 more genes

Synopsis

Field NameValues
NameSHGC-12634
AliasesRH9028; WI-7426
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPTGER2; PTGER2; PTGER2
UniSTS IDUniSTS:58544

Sequences

>Probe|12804052|PRIMERF Forward PCR primer (outermost) (25b)
GTGGTTTTGTAATTTGTTTGAAACC
>Probe|12804052|PRIMERR Reverse PCR primer (outermost) (19b)
TGACCTGCAGTTCCTGGAG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3141586 cr10000SHGC-12634
Homo sapiensradiation hybridGeneMap99-G3141634 cr10000SHGC-12634
Homo sapienslinkageRutgers Map14 cmSHGC-12634

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID58544
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center