Display Settings:

Format

Send to:

Choose Destination
Pr012803962

STS probe D7S2439

Synopsis

Field NameValues
NameD7S2439
AliasesAFMa212xa9; sWSS2491
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:58463

Sequences

>Probe|12803962|PRIMERF Forward PCR primer (outermost) (18b)
GTGGTACATTTGTCACAG
>Probe|12803962|PRIMERR Reverse PCR primer (outermost) (20b)
CATTCTCTCAACTTCTCATC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:3754537
UniSTS IDcontext specific help for: UniSTS ID58463
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center