Display Settings:

Format

Send to:

Choose Destination
Pr012802396

STS probe D20S764 for zinc finger MYND-type containing 8 (ZMYND8) and 4 more genes

Synopsis

Field NameValues
NameD20S764
AliasesMR11599; RH5164; RH57477; WI-6129
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesZMYND8; ZMYND8; ZMYND8; ZMYND8; ZMYND8
UniSTS IDUniSTS:57040

Sequences

>Probe|12802396|PRIMERF Forward PCR primer (outermost) (25b)
GTCATTCCTTCATTGTTCTCTATTG
>Probe|12802396|PRIMERR Reverse PCR primer (outermost) (25b)
AAAGGAGAATTGTATGGTATGTGAA

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map20 cmD20S764
Homo sapiensradiation hybridNCBI RH20487.3 crWI-6129
Homo sapiensradiation hybridWhitehead-RH20301.4 cr3000WI-6129

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID57040
Probe Cross-refcontext specific help for: Probe Cross-refGDB:589498
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center