Display Settings:

Format

Send to:

Choose Destination
Pr012802334

STS probe G10520 for gelsolin (GSN) and 4 more genes

Synopsis

Field NameValues
NameG10520
AliasesCHLC.UTR_00972_X04412; CHLC.UTR_00972_X04412.P37257
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesGSN; LOC100410236; GSN; GSN; GSN
UniSTS IDUniSTS:56986

Sequences

>Probe|12802334|PRIMERF Forward PCR primer (outermost) (20b)
GTCAGTGCCTTTTGGAACTG
>Probe|12802334|PRIMERR Reverse PCR primer (outermost) (22b)
CATTTTAGACAATTTTGCAAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map9 cmG10520

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID56986
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center