Display Settings:

Format

Send to:

Choose Destination
Pr012801596

STS probe D16S3216 for protein kinase C beta (PRKCB) and 3 more genes

Synopsis

Field NameValues
NameD16S3216
AliasesRH14023; RH77632; RH85714; SHGC-12697; SHGC-60969; UTR-00980; WI-7623
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPRKCB; PRKCB; PRKCB; PRKCB
UniSTS IDUniSTS:56316

Sequences

>Probe|12801596|PRIMERF Forward PCR primer (outermost) (21b)
GTACTCTTCCACTTCCGGTCC
>Probe|12801596|PRIMERR Reverse PCR primer (outermost) (21b)
GCCCTTTTCAAGTAGTTTGGG

References

1.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

2.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-G3161307 cr10000SHGC-12697
Homo sapiensradiation hybridTNG1613950 cr50000SHGC-12697
Homo sapienslinkageRutgers Map16 cmD16S3216

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID56316
Probe Cross-refcontext specific help for: Probe Cross-refGDB:677597
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center