Display Settings:

Format

Send to:

Choose Destination
Pr012801416

STS probe D20S827 for NDRG family member 3 (NDRG3) and 2 more genes

Synopsis

Field NameValues
NameD20S827
AliasesRH31974; SHGC-2799
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesNDRG3; NDRG3; NDRG3
UniSTS IDUniSTS:56154

Sequences

>Probe|12801416|PRIMERF Forward PCR primer (outermost) (26b)
GTAATGTCAGACTTATTAAAGGACTC
>Probe|12801416|PRIMERR Reverse PCR primer (outermost) (24b)
AACATAATCTCTGTGAAGACTGGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3201940 cr10000SHGC-2799
Homo sapienslinkageRutgers Map20 cmD20S827
Homo sapiensradiation hybridNCBI RH20324.5 crSHGC-2799

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID56154
Probe Cross-refcontext specific help for: Probe Cross-refGDB:598498
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center