Display Settings:

Format

Send to:

Choose Destination
Pr012801172

STS probe G30939 for staufen double-stranded RNA binding protein 1 (STAU1) and 7 more genes

Synopsis

Field NameValues
NameG30939
AliasDRES50
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSTAU1; STAU1; STAU1; CYP4F22; STAU1; STAU1; STAU1; CYP4F22
UniSTS IDUniSTS:55934

Sequences

>Probe|12801172|PRIMERF Forward PCR primer (outermost) (21b)
GTAAACAATGAATGGAAGCAG
>Probe|12801172|PRIMERR Reverse PCR primer (outermost) (21b)
GGGCTGAAAAGAATGACCTAC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map20 cmG30939

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID55934
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center