Display Settings:

Format

Send to:

Choose Destination
Pr012801084

STS probe D20S889 for ring finger protein 24 (RNF24) and 3 more genes

Synopsis

Field NameValues
NameD20S889
Aliases234TF10; AFM234tf10; HS234TF10; RH31462; RH37494; SHGC-21112; W2437; stSG10714
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesRNF24; RNF24; RNF24; RNF24
UniSTS IDUniSTS:55855

Sequences

>Probe|12801084|PRIMERF Forward PCR primer (outermost) (19b)
GGTTTGGTGGAATCCTCTC
>Probe|12801084|PRIMERR Reverse PCR primer (outermost) (22b)
CATCTTTCAAATGGGATAATGG

References

1.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

2.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

Show All 3 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-G320181 cr10000AFM234tf10
Homo sapienslinkageRutgers Map20 cmD20S889
Homo sapienslinkageMarshfield2011.2 cmAFM234tf10
Homo sapienslinkageGenethon2011 cmAFM234tf10

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID55855
Probe Cross-refcontext specific help for: Probe Cross-refGDB:610728
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center