Display Settings:

Format

Send to:

Choose Destination
Pr012800785

STS probe D7S1874 for glutamate metabotropic receptor 8 (GRM8) and 4 more genes

Synopsis

Field NameValues
NameD7S1874
AliasesAFMa125wh1; sWSS2336
TypeSTS
Application
Source organism
Source sequence
Target genesGRM8; LOC100583361; GRM8; GRM8; GRM8
UniSTS IDUniSTS:55583

Sequences

>Probe|12800785|PRIMERF Forward PCR primer (outermost) (18b)
GGTGTTACGTTTAGTTAC
>Probe|12800785|PRIMERR Reverse PCR primer (outermost) (20b)
GGAATAATGAGAGAAGATTG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:455244
UniSTS IDcontext specific help for: UniSTS ID55583
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center