Display Settings:

Format

Send to:

Choose Destination
Pr012800221

STS probe D2S2700 for APC membrane recruitment protein 3 (AMER3) and 2 more genes

Synopsis

Field NameValues
NameD2S2700
AliasesHSC03E112; WI-6224
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesAMER3; AMER3; LOC718722
UniSTS IDUniSTS:55072

Sequences

>Probe|12800221|PRIMERF Forward PCR primer (outermost) (25b)
GGTCACATTATCCTTTATAGCAACA
>Probe|12800221|PRIMERR Reverse PCR primer (outermost) (20b)
TTGTGTGAGGACTGTGAGGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmD2S2700

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID55072
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678787
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center