Display Settings:

Format

Send to:

Choose Destination
Pr012799937

STS probe D9S1916 for TSC complex subunit 1 (TSC1) and 4 more genes

Synopsis

Field NameValues
NameD9S1916
AliasesCHLC.GCT16D08; CHLC.GCT16D08.P18285; GCT16D08
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTSC1; TSC1; TSC1; TSC1; TSC1
UniSTS IDUniSTS:54817

Sequences

>Probe|12799937|PRIMERF Forward PCR primer (outermost) (20b)
GGGTTTCTCTGGGGTAGAAA
>Probe|12799937|PRIMERR Reverse PCR primer (outermost) (20b)
ATGGTAGGGCACAATGAAGA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map9 cmD9S1916

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID54817
Probe Cross-refcontext specific help for: Probe Cross-refGDB:626213
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center