Display Settings:

Format

Send to:

Choose Destination
Pr012797437

STS probe D15S964 for MINDY lysine 48 deubiquitinase 2 (MINDY2) and 2 more genes

Synopsis

Field NameValues
NameD15S964
AliasesAFMA121ZB9; AFMa121zb9; HSA121ZB9
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMINDY2; MINDY2; MINDY2
UniSTS IDUniSTS:5451

Sequences

>Probe|12797437|PRIMERF Forward PCR primer (outermost) (19b)
AATACCCTGCCTGTCTGTC
>Probe|12797437|PRIMERR Reverse PCR primer (outermost) (22b)
GGGAAATGAGTTTCTGAGATAA

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map15 cmD15S964
Homo sapienslinkageMarshfield1552.33 cmAFMa121zb9
Homo sapienslinkageGenethon1552 cmAFMa121zb9

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID5451
Probe Cross-refcontext specific help for: Probe Cross-refGDB:603203
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center