Display Settings:

Format

Send to:

Choose Destination
Pr012796735

STS probe DXS7357 for doublecortin (DCX) and 3 more genes

Synopsis

Field NameValues
NameDXS7357
AliasesHUMSWX2045; sWXD2045
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesDCX; DCX; DCX; DCX
UniSTS IDUniSTS:54445

Sequences

>Probe|12796735|PRIMERF Forward PCR primer (outermost) (21b)
GGGGGGTTAATGAATAAATGG
>Probe|12796735|PRIMERR Reverse PCR primer (outermost) (19b)
TAGAAGGGGATGCTGAGTG

References

1.

X chromosome map at 75-kb STS resolution, revealing extremes of recombination and GC content.

Nagaraja R, MacMillan S, Kere J, Jones C, Griffin S, Schmatz M, Terrell J, Shomaker M, Jermak C, Hott C, Masisi M, Mumm S, Srivastava A, Pilia G, Featherstone T, Mazzarella R, Kesterson S, McCauley B, Railey B, Burough F, Nowotny V, D'Urso M, States D, Brownstein B, Schlessinger D.

Genome Res. 1997 Mar;7(3):210-22.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmDXS7357
Homo sapiensphysicalWUSTL-XX2 ordinalsWXD2045

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID54445
Probe Cross-refcontext specific help for: Probe Cross-refGDB:556347
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center