Display Settings:

Format

Send to:

Choose Destination
Pr012793737

STS probe WI-7148 for zinc finger protein 286A (ZNF286A) and 4 more genes

Synopsis

Field NameValues
NameWI-7148
AliasesUBE2C-PEN; UTR-01930
TypeSTS
Application
Source organism
Source sequence
Target genesUBE2S; UBE2S; ZNF286A; UBE2S; UBE2S
UniSTS IDUniSTS:54175

Sequences

>Probe|12793737|PRIMERF Forward PCR primer (outermost) (19b)
GGGCTCTCTTCCTCCTTCC
>Probe|12793737|PRIMERR Reverse PCR primer (outermost) (20b)
AACAAATCCAGGTCCCAGTG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:679024
UniSTS IDcontext specific help for: UniSTS ID54175
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center