Display Settings:

Format

Send to:

Choose Destination
Pr012790929

STS probe D16S3122 for C-type lectin domain family 16 member A (CLEC16A) and 1 more gene

Synopsis

Field NameValues
NameD16S3122
Aliases088XC1; AFM088XC1; AFM088xc1; HS088XC1; W2249
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCLEC16A; CLEC16A
UniSTS IDUniSTS:53922

Sequences

>Probe|12790929|PRIMERF Forward PCR primer (outermost) (20b)
GGGATCTGTTCTCAGTTGGC
>Probe|12790929|PRIMERR Reverse PCR primer (outermost) (20b)
TGGGTGACAATTTGTTCACA

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7.

Show All 3 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map16 cmD16S3122
Homo sapienslinkageMarshfield1620.77 cmAFM088xc1
Homo sapienslinkagedeCODE1628.3 cmD16S3122
Homo sapienslinkageGenethon1619.7 cmAFM088xc1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID53922
Probe Cross-refcontext specific help for: Probe Cross-refGDB:613239
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center