Display Settings:

Format

Send to:

Choose Destination
Pr012789420

STS probe DYF85S1

Synopsis

Field NameValues
NameDYF85S1
AliasesDYS235; SY150
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:53784

Sequences

>Probe|12789420|PRIMERF Forward PCR primer (outermost) (20b)
GGGAGAGTCACATCACTTGG
>Probe|12789420|PRIMERR Reverse PCR primer (outermost) (21b)
TTGAATTATCTGCCTGAGTGC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:187552
UniSTS IDcontext specific help for: UniSTS ID53784
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center