Display Settings:

Format

Send to:

Choose Destination
Pr012786058

STS probe D19S649E for plasminogen activator, urokinase receptor (PLAUR) and 4 more genes

Synopsis

Field NameValues
NameD19S649E
AliasesCda0ab07; RH9914
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPLAUR; PLAUR; PLAUR; PLAUR; PLAUR
UniSTS IDUniSTS:53472

Sequences

>Probe|12786058|PRIMERF Forward PCR primer (outermost) (20b)
GGCTTCCTCCAGCTTTTCTC
>Probe|12786058|PRIMERR Reverse PCR primer (outermost) (21b)
CCTACAGACTTGCTGTGTGAC

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB419244.06 cr3000Cda0ab07
Homo sapienslinkageRutgers Map19 cmD19S649E
Homo sapiensradiation hybridNCBI RH19445.7 crCda0ab07

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID53472
Probe Cross-refcontext specific help for: Probe Cross-refGDB:440151; GDB:447661
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center