Display Settings:

Format

Send to:

Choose Destination
Pr012783797

STS probe Cyr61 for cysteine rich protein 61 (Cyr61)

Synopsis

Field NameValues
NameCyr61
TypeSTS
Application
Source organism
Source sequence
Target geneCyr61
UniSTS IDUniSTS:532670

Sequences

>Probe|12783797|PRIMERF Forward PCR primer (outermost) (24b)
AGACCAGAACTGTGAAGATGCGGT
>Probe|12783797|PRIMERR Reverse PCR primer (outermost) (24b)
CTGTCAAAGGACAAGCAGGGCTTT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:5002565
UniSTS IDcontext specific help for: UniSTS ID532670
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center