Display Settings:

Format

Send to:

Choose Destination
Pr012783740

STS probe Il23a for interleukin 23, alpha subunit p19 (Il23a)

Synopsis

Field NameValues
NameIl23a
TypeSTS
Application
Source organism
Source sequence
Target geneIl23a
UniSTS IDUniSTS:532618

Sequences

>Probe|12783740|PRIMERF Forward PCR primer (outermost) (20b)
AATAATGTGCCCCGTATCCA
>Probe|12783740|PRIMERR Reverse PCR primer (outermost) (20b)
CTGGAGGAGTTGGCTGAGTC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:4999630
UniSTS IDcontext specific help for: UniSTS ID532618
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center