Display Settings:

Format

Send to:

Choose Destination
Pr012781803

STS probe Trpm5 for transient receptor potential cation channel, subfamily M, member 5 (Trpm5) and 1 more gene

Synopsis

Field NameValues
NameTrpm5
TypeSTS
Application
Source organism
Source sequence
Target genesTrpm5; Trpm5
UniSTS IDUniSTS:530853

Sequences

>Probe|12781803|PRIMERF Forward PCR primer (outermost) (20b)
ACCTGGCCACTGAAGCTGAT
>Probe|12781803|PRIMERR Reverse PCR primer (outermost) (22b)
CCACCAGATCTTGGTCAGGAAT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:4457692
UniSTS IDcontext specific help for: UniSTS ID530853
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center