Display Settings:

Format

Send to:

Choose Destination
Pr012781633

STS probe D8S1785 for valosin containing protein interacting protein 1 (VCPIP1) and 6 more genes

Synopsis

Field NameValues
NameD8S1785
AliasesAFMB340YG1; AFMb340yg1; B340YG1; HSB340YG1; W6755
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesC8H8orf44; VCPIP1; VCPIP1; LOC464217; VCPIP1; VCPIP1; VCPIP1
UniSTS IDUniSTS:53068

Sequences

>Probe|12781633|PRIMERF Forward PCR primer (outermost) (19b)
GGCCTCTATTTTGCAGATG
>Probe|12781633|PRIMERR Reverse PCR primer (outermost) (21b)
TGCCCAGGAAACCGCCTGATT

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7.

Show All 3 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map8 cmD8S1785
Homo sapienslinkageMarshfield882.84 cmAFMb340yg1
Homo sapienslinkagedeCODE877.01 cmD8S1785
Homo sapienslinkageGenethon882 cmAFMb340yg1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID53068
Probe Cross-refcontext specific help for: Probe Cross-refGDB:611466
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center