Display Settings:

Format

Send to:

Choose Destination
Pr012778690

STS probe D16S2537E for G1 to S phase transition 1 (GSPT1)

Synopsis

Field NameValues
NameD16S2537E
AliasesBda84d02; RH85098; RH85170; RH9842; SHGC-61009; SHGC-61202
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneGSPT1
UniSTS IDUniSTS:52803

Sequences

>Probe|12778690|PRIMERF Forward PCR primer (outermost) (20b)
GGCATCTGCTAGAATCACTG
>Probe|12778690|PRIMERR Reverse PCR primer (outermost) (20b)
CTACCTTATCAAACTGTGCC

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB416163.82 cr3000Bda84d02
Homo sapienslinkageRutgers Map16 cmD16S2537E

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID52803
Probe Cross-refcontext specific help for: Probe Cross-refGDB:447024; GDB:450061
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center