Display Settings:

Format

Send to:

Choose Destination
Pr012776864

STS probe D19S1093 for pregnancy-specific beta-1-glycoprotein 2 (LOC456086)

Synopsis

Field NameValues
NameD19S1093
AliasesRH29259; SHGC-11646
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneLOC456086
UniSTS IDUniSTS:52626

Sequences

>Probe|12776864|PRIMERF Forward PCR primer (outermost) (22b)
GGCACTCAGATATTTTGGAAGG
>Probe|12776864|PRIMERR Reverse PCR primer (outermost) (20b)
AAGATGCAACCATGAAAGGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3192012 cr10000SHGC-11646
Homo sapiensradiation hybridNCBI RH19445.7 crSHGC-11646

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:737199
UniSTS IDcontext specific help for: UniSTS ID52626
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center